DWMED

Breadcrumbs


ekstremofile – organizmy żyjące w ekstremalnych warunkach środowiskowych

Wiele bakterii to ekstremofile – organizmy żyjące w ekstremalnych warunkach środowiskowych. Skrajne wartości określonych czynników fizycznych i chemicznych są warunkiem koniecznym do prawidłowego zajścia procesów metabolicznych u ekstremofili.
W zależności od wartości optymalnej temperatury wzrostu wyróżnia się wśród ekstremofili:

• psychrofile – organizmy, które nie rosną w temperaturze powyżej 20 °C, a optymalne warunki do ich rozwoju stwarza temperatura poniżej 15 °C. Psychrofile wykształciły wiele adaptacji do niskich wartości temperatury, wśród których można wyróżnić mechanizmy
chroniące przed nadmiernym zmniejszeniem płynności ich błon komórkowych;

• termofile – organizmy, których optymalna temperatura wzrostu wynosi ponad 50 °C. Maksymalna temperatura umożliwiająca życie wynosi 122 °C. Wysoka temperatura
powoduje wzrost płynności błony komórkowej oraz destabilizuje strukturę białek i kwasów nukleinowych termofili. Z tego powodu w białkach termofili znajdują się liczne mostki disiarczkowe, a cząsteczki rRNA i tRNA mają wysoką zawartość par zasad GC.

Enzymy wytwarzane przez ekstremofile są wykorzystywane w biotechnologii.

Na podstawie: A. Zabłotni, A. Dziadosz, Ekstremofile – mikroorganizmy z przeszłością i z przyszłością,
„Postępy Mikrobiologii” 52(4), 2013.

 

1. Określ, które z poniższych modyfikacji składu chemicznego lipidów błony komórkowej stanowią adaptację do życia w niskiej temperaturze. Zaznacz T, jeśli modyfikacja jest adaptacją do życia w niskiej temperaturze, albo N – jeśli nią nie jest.

 

ekstremofile – organizmy żyjące w ekstremalnych warunkach środowiskowych

 

2. Podaj nazwę aminokwasu niezbędnego do wytworzenia mostków disiarczkowych, stabilizujących strukturę przestrzenną białek bakterii termofilnych.

 

 

3. Wykaż, że stabilność cząsteczek rRNA i tRNA bakterii termofilnych zwiększa się wraz ze wzrostem zawartości w ich cząsteczkach par zasad GC kosztem zawartości par zasad AU.

 

 

4. Określ, która grupa organizmów – psychrofile czy termofile – stanowi źródło polimeraz DNA wykorzystywanych do PCR. Odpowiedź uzasadnij.

 

5. Która cecha występuje u bakterii – organizmów prokariotycznych? Zaznacz właściwą
odpowiedź spośród podanych.

A. obecność mitochondriów
B. rybosomy o współczynniku sedymentacji równym 80S
C. chityna jako główny składnik ściany komórkowej
D. translacja cząsteczki mRNA rozpoczynająca się przed zakończeniem jej syntezy


Bioluminescencja - niezwykła zdolność komórek

Bioluminescencja to zdolność żywych komórek do emisji promieniowania w zakresie światła widzialnego. Występuje u wielu owadów. Przykładowo: duże drapieżne samice tropikalnych świetlików Photuris lugubris wykształciły umiejętność wabienia swoich ofiar – małych
samców świetlików Photinus palaciosi – poprzez imitację charakterystycznego wzoru sygnałów świetlnych wysyłanych przez samice Photinus palaciosi.
Bioluminescencja świetlików jest wynikiem reakcji utleniania lucyferyny z udziałem enzymu – lucyferazy. Aby ta reakcja mogła zajść, niezbędna okazuje się również obecność ATP. Poniżej przedstawiono równanie reakcji.

 

 

Bioluminescencja – niezwykła zdolność komórek

 

U świetlików ta reakcja zachodzi w wyspecjalizowanych narządach ulokowanych w segmentach odwłokowych i jest regulowana przez dopływ tlenu do świecących komórek.
Lucyferynę i lucyferazę świetlika wykorzystuje się do wykrywania mikroorganizmów w różnych próbkach. Takie testy stosuje się w ocenie czystości, np. powierzchni szpitalnych i okazów muzealnych.

 

1. Przedstaw korzyść, jaką odnoszą samice świetlików Photuris lugubris dzięki umiejętności wabienia swoich ofiar.

 

2. Uzupełnij poniższe zdania tak, aby w poprawny sposób opisywały wykorzystanie lucyferyny i lucyferazy. W każdym nawiasie podkreśl właściwe określenie.

Testy wykorzystujące lucyferynę i lucyferazę świetlików w wykrywaniu mikroorganizmów opierają się na założeniu, że (AMP / ATP) jest związkiem chemicznym wytwarzanym w procesie oddychania komórkowego, którego stężenie (wzrasta / spada) wraz ze wzrostem liczby mikroorganizmów znajdujących się w danej próbce. O wykryciu bakterii świadczy (ustanie / wystąpienie) bioluminescencji.

 

3. Podaj nazwę tego narządu układu oddechowego świetlików, który odpowiada za doprowadzenie tlenu bezpośrednio do komórek ich ciała.

 

 




przebieg kolorymetrycznej hybrydyzacji mRNA in situ

Na poniższym schemacie przedstawiono przebieg kolorymetrycznej hybrydyzacji mRNA in situ. Ta technika pozwala wykrywać transkrypty genów bezpośrednio w badanych komórkach dzięki reakcji zachodzącej z udziałem substancji NBT+BCIP. Rozpad tej substancji pod wpływem fosfatazy alkalicznej prowadzi do strącania ciemnobrązowych lub fioletowych kryształów formazanu.

przebieg kolorymetrycznej hybrydyzacji mRNA in situ

1. Przeanalizuj schemat, a następnie określ kolejność procedur niezbędnych do przeprowadzenia
reakcji kolorymetrycznej hybrydyzacji mRNA in situ.

przebieg kolorymetrycznej hybrydyzacji mRNA in situ

2. Sondy RNA wykorzystywane w reakcji hybrydyzacji mRNA in situ można syntezować na drodze transkrypcji fragmentu sekwencji DNA badanego genu. Reakcję transkrypcji najczęściej przeprowadza się z użyciem bakteriofagowej polimerazy RNA T7, katalizującej syntezę RNA w kierunku 5′ → 3′, która wiąże się do specyficznej sekwencji promotorowej (5′ CATAATACGACTCACTATAGGG 3′) poprzedzającej transkrybowany odcinek DNA. Jednym ze sposobów wprowadzania promotora dla polimerazy T7 do sekwencji DNA badanego genu jest dodanie go jako nawis (ang. overhang) do jednego ze starterów wykorzystywanych w reakcji PCR.
Na poniższym rysunku przedstawiono jeden z możliwych schematów reakcji PCR z promotorem dla polimerazy T7 dodanym jako nawis na końcu 5′ startera FWD (ang. forward), przyłączającym się do nici antysensownej (matrycowej) badanego genu. Starter REV (ang. reverse) przyłącza się do nici sensownej (kodującej).

 

 

przebieg kolorymetrycznej hybrydyzacji mRNA in situ


Określ, która kombinacja par starterów umożliwi otrzymanie matrycy DNA, z której na drodze transkrypcji z użyciem polimerazy T7 będzie można uzyskać działającą sondę RNA.

A. starter FWD z nawisem na końcu 5′ oraz starter REV
B. starter FWD oraz starter REV z nawisem na końcu 5′
C. starter FWD z nawisem na końcu 3′ oraz starter REV
D. starter FWD oraz starter REV z nawisem na końcu 3′


choroba Creutzfeldta-Jakoba (CJD)

Wśród ludzi z plemienia Fore uprawiany był rytualny pośmiertny kanibalizm. Zanim zaprzestano tego obrządku w latach 60. ubiegłego stulecia był on przyczyną rozprzestrzeniania się śmiertelnej i nieuleczalnej choroby prionowej zwanej kuru – prawdopodobnie zapoczątkowanej przez wystąpienie przypadku choroby Creutzfeldta-Jakoba (CJD) u jednego z członków społeczności.
Choroba kuru znana wyłącznie wśród ludności Fore ma okres utajenia trwający od 10 nawet do 50 lat, a śmierć następuje w ciągu 3–12 miesięcy od wystąpienia pierwszych objawów choroby.
Przyczyną chorób prionowych – zarówno CJD, jak i kuru – jest białko PrP (253 reszty aminokwasowe) kodowane przez gen PRNP, znajdujący się na krótkim ramieniu chromosomu 20. Białko w formie natywnej (PrPC) pełni dotąd nieokreśloną rolę w komórkach nerwowych, jednak przyjmując nieprawidłową konformację (PrPSc) tworzy agregaty białkowe składające się z wielu cząsteczek PrPSc – cząstki prionowe – które są patogenem chorób prionowych.

Warianty białka PrP wynikające z polimorfizmu genu PRNP decydują o przebiegu chorób prionowych. Na przykład w pozycji 129. białka PrP może występować metionina (M129) lub walina (V129) – homozygoty M129M129 mają szybszy przebieg CJD niż heterozygoty M129V129 albo homozygoty V129V129. W prawidłowym białku PrP w pozycji 178. występuje kwas asparaginowy (D178). Substytucja na asparaginę (N178) powoduje, że osoba, u której występuje białko z taką substytucją, niezależnie od jego udziału w puli cząsteczek PrP, na pewno zachoruje na chorobę prionową – w przypadku wariantu M129M129 będzie to rodzinna śmiertelna bezsenność, natomiast w przypadku V129V129 – dziedziczna forma CJD. W przypadku heterozygot objawy są niecharakterystyczne.

W 2009 r. opisano nowy wariant białka PrP dotyczący pozycji 127. W populacji światowej w tej pozycji występuje glicyna (G127), jednak wśród członków społeczności Fore wykryto wariant z waliną (V127), którego występowanie silnie korelowało z częstością występowania kuru w danym rejonie.
Badacze postanowili sprawdzić wpływ substytucji aminokwasowej w pozycji 127. na patogenezę chorób prionowych, wykorzystując myszy laboratoryjne, u których w rejonie 113–137 sekwencja aminokwasowa jest taka sama jak u ludzi, z wyjątkiem ewentualnych zmian w pozycjach 127 lub 129, wynikających z naturalnego polimorfizmu genu PRNP albo celowo wprowadzonych zmian.

Na schemacie przedstawiono przebieg oraz wynik przeprowadzonego doświadczenia. Skrzyżowano ze sobą myszy homozygotyczne pod względem kodonu 127 i 129 w genie PRNP, co doprowadziło do uzyskania heterozygotycznych myszy. Część z nich różniła się stosunkiem zawartości wariantów białka PrP, ponieważ użyto dwóch szczepów homozygotycznych myszy V127M129/V127M129, które różniły się stopniem ekspresji tego białka.

choroba Creutzfeldta-Jakoba (CJD)

1. Określ, które stwierdzenia dotyczące chorób prionowych są prawdziwe, a które fałszywe.

choroba Creutzfeldta-Jakoba (CJD)

2. Kobieta z PrP M129 D178/ V129 N178 i mężczyzna z PrP M129 D178 /V129 D178 spodziewają się dziecka.

Określ prawdopodobieństwo urodzenia dziecka, które w ciągu swojego życia zachoruje na dziedziczną postać CJD.

A. 0%
B. 12,5%
C. 25%
D. 50%
E. 100%

 

3. Badacze, wykonując substytucję G127→V127, przeprowadzili mutagenezę kodonu GGC→GTC.

Określ pozycję zamienionego nukleotydu w dojrzałym mRNA PRNP, licząc od pierwszego nukleotydu kodonu start.

A. 127
B. 128
C. 378
D. 380
E. 381

 

4. Określ, które stwierdzenia dotyczące wariantów PrP G127 i V127 sformułowane na podstawie przeprowadzonego doświadczenia są prawdziwe, a które – fałszywe.

choroba Creutzfeldta-Jakoba (CJD)

5. Uzupełnij w poniższym tekście luki (1.–3.) wyrażeniami z tabeli, wybierając w każdym przypadku jedno z dwóch zaproponowanych.

Wariant PrP V127 powstał w wyniku (1) i rozprzestrzenił się w populacji Fore dzięki doborowi naturalnemu i dlatego częstość występowania kuru na danym obszarze silnie koreluje z częstością występowania (2) wśród ludności Fore. Allel kodujący wariant PrP V127 dziedziczy się (3) z pierwszym prawem Mendla.

choroba Creutzfeldta-Jakoba (CJD)









Paginacja